Journal: The FASEB Journal

Article Title: A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis

doi: 10.1096/fj.13-241760

Figure Lengend Snippet: Histone H3 is repressively hypermethylated and HMT recruitment is increased at the COX-2 promoter in F-IPFs. Confluent and serum-starved F-NLs and F-IPFs were incubated with IL-1β (1 ng/ml) for the times indicated. The protein-DNA complexes were cross-linked by formaldehyde treatment, and chromatin pellets were extracted and sonicated. H3K4me3 ( A ), H3K9me3 ( B ), H3K27me3 ( C ), G9a ( D ), SUV39H1 ( E ), EZH2 ( F ), and total histone H3 ( A–C ) were immunoprecipitated with specific antibodies. The associated COX-2 promoter DNA was amplified by real-time PCR, and the amount was calculated and normalized to total histone H3 ( A–C ) or to input control ( D–F ). Data are expressed as means ± sem from experiments with 6 separate F-NL and F-IPF cell lines performed in duplicate. * P < 0.05, ** P < 0.005 vs. corresponding F-NLs.

Article Snippet: Then 600 ng of predesigned siRNA directed against human G9a (target sequence: CACCATGAACATCGATCGCAA, catalog no. SI00091203, Qiagen), EZH2 (target sequence: CAGACGAGCTGATGAAGTAAA, catalog no. SI00063966, Qiagen), or ALLStars negative control siRNA (with no homology to any known mammalian gene, catalog no. 1027280; Qiagen) was diluted in 1.6 ml of culture medium, 48 μl of HiPerFect Transfection Reagent was added to the diluted siRNA, and the preparation was mixed and incubated at room temperature for 10 min.

Techniques: Incubation, Sonication, Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction, Control

Journal: The FASEB Journal

Article Title: A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis

doi: 10.1096/fj.13-241760

Figure Lengend Snippet: HP1, PRC1, and repressive epigenetic enzymes are associated with the COX-2 promoter in F-IPFs. Confluent F-IPFs were serum starved for 24 h. The protein-DNA complexes were cross-linked by formaldehyde treatment, and chromatin pellets were extracted and sonicated. H3K9me3 ( A ), H3K27me3 ( B ), HP1 ( C and D ), EZH2 ( E ), and EED ( F ) were immunoprecipitated with specific antibodies first, and then the IPs were immunoprecipitated again with antibodies against HP1 ( A ), PRC1 ( B ), G9a ( C ), Dnmt1, Dnmt3a ( C and E ), EED ( E ), and NCoR, CoREST, and mSin3a ( D , F ). The associated COX-2 promoter DNA was amplified by real-time PCR, and the amount was calculated and normalized to input control. Data are expressed as means ± sem from experiments with 6 separate F-IPF cell lines performed in duplicate.

Article Snippet: Then 600 ng of predesigned siRNA directed against human G9a (target sequence: CACCATGAACATCGATCGCAA, catalog no. SI00091203, Qiagen), EZH2 (target sequence: CAGACGAGCTGATGAAGTAAA, catalog no. SI00063966, Qiagen), or ALLStars negative control siRNA (with no homology to any known mammalian gene, catalog no. 1027280; Qiagen) was diluted in 1.6 ml of culture medium, 48 μl of HiPerFect Transfection Reagent was added to the diluted siRNA, and the preparation was mixed and incubated at room temperature for 10 min.

Techniques: Sonication, Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction, Control

Journal: The FASEB Journal

Article Title: A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis

doi: 10.1096/fj.13-241760

Figure Lengend Snippet: COX-2 promoter DNA methylation and Dnmt association with the COX-2 promoter are increased in F-IPFs. A ) Confluent F-NLs and F-IPFs were serum starved for 24 h and then lysed. DNA was extracted. Methylated DNA was immunoprecipitated with an antibody against 5-methylcytosine. The associated DNA was amplified by real-time PCR using specific primers for different regions of the COX-2 promoter and its upstream and downstream regions. B–D ) Confluent and serum-starved F-NLs and F-IPFs were incubated with IL-1β (1 ng/ml) for the times indicated. The protein-DNA complexes were cross-linked by formaldehyde treatment, and chromatin pellets were extracted and sonicated. Dnmt1 ( B ), Dnmt3a ( C ), and MeCP2 ( D ) were immunoprecipitated with specific antibodies. The associated COX-2 promoter DNA was amplified by real-time PCR, and the amount was calculated and normalized to input control. E , F ) Confluent F-IPFs were serum starved for 24 h. The protein-DNA complexes were cross-linked by formaldehyde treatment, and chromatin pellets were extracted and sonicated. MeCP2 was immunoprecipitated with specific antibody first, and then the IPs were immunoprecipitated again with antibodies against G9a, EZH2, Dnmt1, and Dnmt3a ( E ) and NCoR, CoREST, and mSin3a ( F ). The associated COX-2 promoter DNA was amplified by real-time PCR, and the amount was calculated and normalized to input control. Data are expressed as means ± sem from experiments with 6 separate F-NL and/or F-IPF cell lines performed in duplicate. * P < 0.05 vs. corresponding F-NLs.

Article Snippet: Then 600 ng of predesigned siRNA directed against human G9a (target sequence: CACCATGAACATCGATCGCAA, catalog no. SI00091203, Qiagen), EZH2 (target sequence: CAGACGAGCTGATGAAGTAAA, catalog no. SI00063966, Qiagen), or ALLStars negative control siRNA (with no homology to any known mammalian gene, catalog no. 1027280; Qiagen) was diluted in 1.6 ml of culture medium, 48 μl of HiPerFect Transfection Reagent was added to the diluted siRNA, and the preparation was mixed and incubated at room temperature for 10 min.

Techniques: DNA Methylation Assay, Methylation, Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction, Incubation, Sonication, Control

Journal: The FASEB Journal

Article Title: A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis

doi: 10.1096/fj.13-241760

Figure Lengend Snippet: Epigenetic inhibitors of G9a, EZH2, and Dnmt1 reduce H3K9me3 and H3K27me3 and increase histone H3 and H4 acetylation at the COX-2 promoter in F-IPFs. F-IPFs were incubated without or with BIX-01294 (100 nM), RG109 (5 μM), or DZNep (10 nM) in medium with serum for 2 d before they reached confluence and then were treated without or with the inhibitors in serum-free medium for 1 d before being incubated without or with IL-1β (1 ng/ml) in the presence or absence of the inhibitors for a further 4 h. The protein-DNA complexes were then cross-linked by formaldehyde treatment, and chromatin pellets were extracted and sonicated. H3K9me3 ( A ), HP1 ( B ), H3K27me3 ( C ), and acetylated histone H3 ( D ) and H4 ( E ) were immunoprecipitated with specific antibodies. The associated COX-2 promoter DNA was amplified by real-time PCR, and the amount was calculated and normalized to total histone H3 ( A , C , D ), total histone H4 ( E ), or input control ( B ). Data are expressed as means ± sem from experiments with 6 separate F-IPF cell lines performed in duplicate. * P < 0.05, ** P < 0.005, *** P < 0.001 vs. corresponding untreated cells.

Article Snippet: Then 600 ng of predesigned siRNA directed against human G9a (target sequence: CACCATGAACATCGATCGCAA, catalog no. SI00091203, Qiagen), EZH2 (target sequence: CAGACGAGCTGATGAAGTAAA, catalog no. SI00063966, Qiagen), or ALLStars negative control siRNA (with no homology to any known mammalian gene, catalog no. 1027280; Qiagen) was diluted in 1.6 ml of culture medium, 48 μl of HiPerFect Transfection Reagent was added to the diluted siRNA, and the preparation was mixed and incubated at room temperature for 10 min.

Techniques: Incubation, Sonication, Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction, Control

Journal: The FASEB Journal

Article Title: A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis

doi: 10.1096/fj.13-241760

Figure Lengend Snippet: G9a and EZH2 siRNAs reduce H3K9me3 and H3K27me3 and increase histone H3 and H4 acetylation and H3K4me3 at the COX-2 promoter in F-IPFs. F-IPFs were transfected with control siRNA, G9a siRNA, or EZH2 siRNA in medium with serum for 2 d and serum starved for 1 d before being incubated without or with IL-1β (1 ng/ml) in the presence or absence of the siRNAs for a further 4 h. The protein-DNA complexes were then cross-linked by formaldehyde treatment, and chromatin pellets were extracted and sonicated. H3K9me3 ( A ), HP1 ( B ), H3K27me3 ( C ), acetylated histone H3 ( D ) and H4 ( E ), CBP, p300, PCAF ( F ), and H3K4me3 ( G ) were immunoprecipitated with specific antibodies. The associated COX-2 promoter DNA was amplified by real-time PCR, and the amount was calculated and normalized to total histone H3 ( A , C , D , G ), total histone H4 ( E ), or input control ( B , F ). Data are expressed as means ± sem from experiments with 6 separate F-IPF cell lines performed in duplicate. * P < 0.05, ** P < 0.005 vs. corresponding untreated or control cells.

Article Snippet: Then 600 ng of predesigned siRNA directed against human G9a (target sequence: CACCATGAACATCGATCGCAA, catalog no. SI00091203, Qiagen), EZH2 (target sequence: CAGACGAGCTGATGAAGTAAA, catalog no. SI00063966, Qiagen), or ALLStars negative control siRNA (with no homology to any known mammalian gene, catalog no. 1027280; Qiagen) was diluted in 1.6 ml of culture medium, 48 μl of HiPerFect Transfection Reagent was added to the diluted siRNA, and the preparation was mixed and incubated at room temperature for 10 min.

Techniques: Transfection, Control, Incubation, Sonication, Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction

Journal: The FASEB Journal

Article Title: A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis

doi: 10.1096/fj.13-241760

Figure Lengend Snippet: G9a and EZH2 inhibitors and siRNAs reduce COX-2 promoter DNA methylation in F-IPFs. A , B ) F-IPFs were incubated without or with BIX-01294 (100 nM), DZNep (10 nM), or RG109 (5 μM) in medium with serum for 2 d before they reached confluence and then were treated without or with the inhibitors in serum-free medium for 1 d. Cells were then lysed, and DNA was extracted and sheared. A ) Methylated DNA was immunoprecipitated with an antibody against 5-methylcytosine. The associated DNA was amplified by real-time PCR using specific primers for the COX-2 promoter DNA. B ) The protein-DNA complexes were cross-linked by formaldehyde treatment and chromatin pellets were extracted and sonicated. MeCP2 was immunoprecipitated with a specific antibody. The associated COX-2 promoter DNA was amplified by real-time PCR, and the amount was calculated and normalized to the input control. C ) F-IPFs were transfected with control siRNA, G9a siRNA, or EZH2 siRNA in medium with serum for 2 d and serum starved for 1 d. The cells were then lysed, and DNA was extracted and sheared. Methylated DNA was immunoprecipitated with an antibody against 5-methylcytosine. The associated DNA was amplified by real-time PCR using specific primers for the COX-2 promoter DNA with samples from F-NLs as a reference. Data are expressed as means ± sem from experiments with 6 separate F-IPF and F-NL cell lines performed in duplicate. * P < 0.05 vs. control cells.

Article Snippet: Then 600 ng of predesigned siRNA directed against human G9a (target sequence: CACCATGAACATCGATCGCAA, catalog no. SI00091203, Qiagen), EZH2 (target sequence: CAGACGAGCTGATGAAGTAAA, catalog no. SI00063966, Qiagen), or ALLStars negative control siRNA (with no homology to any known mammalian gene, catalog no. 1027280; Qiagen) was diluted in 1.6 ml of culture medium, 48 μl of HiPerFect Transfection Reagent was added to the diluted siRNA, and the preparation was mixed and incubated at room temperature for 10 min.

Techniques: DNA Methylation Assay, Incubation, Methylation, Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction, Sonication, Control, Transfection

Journal: The FASEB Journal

Article Title: A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis

doi: 10.1096/fj.13-241760

Figure Lengend Snippet: Epigenetic inhibitors of G9a, EZH2, and Dnmt1 restore COX-2 expression and PGE 2 production in F-IPFs. F-IPFs were incubated without or with BIX-01294 (100 nM), DZNep (10 nM), or RG108 (5 μM) in medium with serum for 2 d before they reached confluence and then were treated without or with the inhibitors in serum-free medium for 1 d before being incubated without or with IL-1β (1 ng/ml) in the presence or absence of the inhibitors for a further 4 h ( A ) or 24 h ( B , C ). A ) Total RNA was isolated, and mRNA levels of COX-2 and the internal control β 2 -microglobulin (β2M) were determined by real-time RT-PCR. The data are calculated as the ratio of COX-2 mRNA and β2M mRNA and are expressed as means ± sem of 6 separate experiments performed in duplicate. B ) Total cell lysates were collected for Western blotting analysis of COX-2 with GAPDH as the loading control. Data are representative of 3 separate experiments with different F-IPF cell lines. Relative density was calculated by normalizing the density of the COX-2 bands against that of the GAPDH bands from 3 separate experiments. C ) Culture media were collected for PGE 2 assay. For panels A , C , data are expressed as means ± sem from experiments with 6 separate F-IPF cell lines performed in duplicate. * P < 0.05, ** P < 0.005 vs. corresponding untreated cells.

Article Snippet: Then 600 ng of predesigned siRNA directed against human G9a (target sequence: CACCATGAACATCGATCGCAA, catalog no. SI00091203, Qiagen), EZH2 (target sequence: CAGACGAGCTGATGAAGTAAA, catalog no. SI00063966, Qiagen), or ALLStars negative control siRNA (with no homology to any known mammalian gene, catalog no. 1027280; Qiagen) was diluted in 1.6 ml of culture medium, 48 μl of HiPerFect Transfection Reagent was added to the diluted siRNA, and the preparation was mixed and incubated at room temperature for 10 min.

Techniques: Expressing, Incubation, Isolation, Control, Quantitative RT-PCR, Western Blot

Journal: The FASEB Journal

Article Title: A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis

doi: 10.1096/fj.13-241760

Figure Lengend Snippet: G9a and EZH2 siRNAs restore COX-2 expression and PGE 2 production in F-IPFs. A , B ) F-IPFs were transfected with control siRNA, G9a siRNA, or EZH2 siRNA in medium with serum for 2 d and serum starved for 1 d. Total RNA was isolated, and mRNA levels of G9a ( A ) and EZH2 ( B ) were determined by real-time RT-PCR. The data are calculated as the ratio of G9a and EZH2 mRNA and the internal control β 2 -microglobulin (β2M) mRNA. C−F ) F-IPFs transfected with or without siRNAs were serum starved for 1 d before being incubated without or with IL-1β (1 ng/ml) for a further 4 h ( C ) or 24 h ( D−F ). C ) Total RNA was isolated, and mRNA levels of COX-2 were determined by real-time RT-PCR. The data are calculated as the ratio of COX-2 mRNA and the internal control β2M mRNA. D ) Total cell lysates were collected for Western blotting analysis of COX-2, G9a, and EZH2 with β2M as the loading control. Data are representative of 3 separate experiments with different F-IPF cell lines. E ) Relative density of the Western blot was calculated by normalizing the density of the COX-2, EZH2, and G9a bands against that of the β2M bands from 3 separate experiments. F ) Culture media were collected for PGE 2 assay. For panels A−C and F , data are expressed as means ± sem from experiments with 6 separate F-IPF cell lines performed in duplicate. * P < 0.05, ** P < 0.005 vs. corresponding control or untreated cells.

Article Snippet: Then 600 ng of predesigned siRNA directed against human G9a (target sequence: CACCATGAACATCGATCGCAA, catalog no. SI00091203, Qiagen), EZH2 (target sequence: CAGACGAGCTGATGAAGTAAA, catalog no. SI00063966, Qiagen), or ALLStars negative control siRNA (with no homology to any known mammalian gene, catalog no. 1027280; Qiagen) was diluted in 1.6 ml of culture medium, 48 μl of HiPerFect Transfection Reagent was added to the diluted siRNA, and the preparation was mixed and incubated at room temperature for 10 min.

Techniques: Expressing, Transfection, Control, Isolation, Quantitative RT-PCR, Incubation, Western Blot

Journal: The FASEB Journal

Article Title: A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis

doi: 10.1096/fj.13-241760

Figure Lengend Snippet: A hypothetical model depicting the central role of G9a- and EZH2-mediated histone methylation and the interdependent and mutually reinforcing crosstalk between histone methylation and DNA methylation in COX-2 epigenetic silencing in IPF. G9a- and EZH2-mediated H3K9me3 and H3K27me3 result in the recruitment of Dnmts and HDAC-containing complexes via HP1 and EZH2/EED, respectively, to the COX-2 promoter, which then leads to or reinforces DNA methylation and histone deacetylation. DNA methylation in turn causes the recruitment of G9a, EZH2, and HDAC-containing complexes through MeCP2 to strengthen H3K9me3, H3K27me3, and histone deacetylation, leading to reinforced epigenetic silencing of the COX-2 gene in IPF. Therefore, G9a- and EZH2-mediated H3K9me3 and H3K27me3 interact with DNA methylation in a bidirectional and mutually dependent manner to reinforce COX-2 epigenetic silencing in IPF. Disruption of any of these epigenetic modifications by inhibition or knockdown of G9a, EZH2, or Dnmt leads to the removal of the other repressive epigenetic modifications, resulting in an active chromatin state and reactivation of COX-2 in IPF.

Article Snippet: Then 600 ng of predesigned siRNA directed against human G9a (target sequence: CACCATGAACATCGATCGCAA, catalog no. SI00091203, Qiagen), EZH2 (target sequence: CAGACGAGCTGATGAAGTAAA, catalog no. SI00063966, Qiagen), or ALLStars negative control siRNA (with no homology to any known mammalian gene, catalog no. 1027280; Qiagen) was diluted in 1.6 ml of culture medium, 48 μl of HiPerFect Transfection Reagent was added to the diluted siRNA, and the preparation was mixed and incubated at room temperature for 10 min.

Techniques: Methylation, DNA Methylation Assay, Disruption, Inhibition, Knockdown